jueves, julio 9

¿Y usted por que me visita?

He visto y me he reído miles de veces leyendo la manera en que la gente "cae" en el blog de alguien,  aquí esta la primera entrega de ¿Por que pasé por su mente?:

Algunas llegaron por motivos médicos/anatómicos o... algo así.

  • Trastornos de la personalidad esquizotipico: fijo, fijo, fijo no escribí sobre eso, a menos que el conjunto de post que poseo indiquen que tengo esos trastornos... en fin, un trastorno esquizotípico es cuando a una persona se le dificultan las relaciones interpersonales y tienen alteraciones en los patrones de pensamiento, conducta y apariencia. Sin duda hubiera sido más útil visitar a wiki.
  • Trastornos esquizoides y chakras: vieran lo que me costó hacer la relación, me imagino que debería hacer el test de chakras y luego visitar wiki... 
  • Como puedo saber que mis chakras estan despertados: jajaja les grita, los agita y en casos extremos les tira agua; si no se mueven es que siguen dormidos.
  • Consejos en mi mente: para algunos eso es una patología... eso de escuchar voces en su mente...
  • Fotos de las peores enfermedades: me sabía una pag buenísima (traducción: venían cosas catalogadas popularmente como asquerosas) pero ni al caso ahorita no me acuerdo.
  • Pene diminuto: si, ví uno. Para que alguien busca eso? Este semestre vi que los pacientes afectados con una enfermedad que se llama Prader-Willis tienen micropene (que risa esa palabra), tal ves le sirva querido visitante.
Otros por motivos agronómicos
  • La agricultura incipiente: seguro se cabreó cuando vió de que iba el post jeje
  • Matar la oruga del tomate: mi mamá les hecha sal, los pueden leer aquí, para más info consultar con Galci que fijo sabe más del asunto.

Unos pocos por motivos científicos

  • ataacttcgtataactgactgactgtatacgaagttat: Así a simple vista parece el ADN de hemoglobina... pufff jajaja ni idea, buscaban el adn de algo en mi blog? Quien sabe que cosa anormal escribí yo para que saliera en los resultados cuando alguien buscaba eso en google... (corregido por el siempre creído Mister Genética)

Otros por motivos personales... muy personales

  • Ayer empeze a fumar: en serio? mirá vos
  • Como empece fumar: diay... me imagino que el paso inicial es comprar un cigarro,metérselo a la boca y juntarlo con fuego. Bueno poniéndose serios, no se usted pero yo empecé a fumar así.
  • Cómo coger en público: ok.. dije que eran personales no? Si es cierto escribí un manual de como hacerlo... fijo alguien de mi facu le podría ayudar, yo no.
  • Consejos para no sentir miedo al exponer?: que ternura, espero le hayan servido los que me dieron a mí.
  • Frases de disculpas: me se unas cuantas pero la mejor es Lo Siento.

Muchos por motivos ajenos a mi control:

  • Diosa del reggaeton se le salio un seno: juaz!!! Megaprimo ve lo que me pasa por juntarme con usted, me contagio jejej. Si quieren verlo está aquí.
  • El flow la diosa del reggaeton: lo siento, no me aprendí ninguno...
  • Quienes ganaron en la diosa del reggaeton: Repretel..

Unos por razones sin explicación

  • El respeto por mi mente: cri cri
  • Entradas premier Harry Potter: esas entradas? las rifé hace montones y era para la premier en Londres... si huevon. Por cierto se estrena este viernes!!!!!!!

Y, algunos sabían exactamente que buscaban

  • Blogs de estudiantes de medicina de ucr: jajaja ok, me andan buscando.
  • wtf: preciso y concreto

En fin, sea cual sea la extraña razón por la que llegó a mi humilde blog: Muchas Gracias.

20 comentarios:

Anónimo dijo...

Ja jaa yo deje de revisar eso, de fijo era por la palabra puta... ja jaaa.

Micropene.... WTF!!

Ja jaa jueputa tema que me han preguntado tantas veces.

La Morada dijo...

je je je je La gente busca cada cosa, que de verdad uno a veces se queda asustado.

En mi blog la mitad de las visitas son buscando el video de Pamela Alfaro ¬¬U En mi vida vuelvo a publicar sobre eso!!!!!!!!

ja ja ja Saluditos Dica!!

GAlcidesS dijo...

M`hija, un dedazo por ahí:

"ataacttcgtataactgactgactgtatacgaagttat: Así a simple vista parece el ARN de hemoglobina..." FAIL!

Recuerde que el ARN tiene Uracilo en la cadena en lugar de Timina, así pues, la secuencia sería de ADN.

Y si, analytics le señala a uno cada búsqueda que jue!


Dica dijo...

Puta papá Galcides, me mató, majó y pisoteó al mismo tiempo, tiene la boca o el dedo embarrado de razón, pasé toda la mañana explicándole traducción y transcripción a mi hermanita de sétimo como estuviera estudiándo bioquímica y veo esa "secuencia" y pufff mamé feísimo... si, si ADN.

Petite: jeje yo nunca lo había revisado antes, déjeme disfrutar de mi vida computacional jeje

Moradita: uno menciona algo, cualquier cosa como x ej la diosa del saguatón y puff todo el mundo llegs buscando cochinadas... que vida, que gente, que galcides por encontrar errores en mi post


PS. Hasta al mejor mono...

Palas dijo...

jajajaja ve vos por que caminos se va a terminar llegando a un blog... ummm yo deje de revisar el mío hace tiempo o.0

weno, Dica María, espero que tes bien, yo aqui enfermita así que si ocupa un modelo para examinar o no sé, heyyy ni se le ocurra donar o vender mis organos! bien que en el tráfico de organos me he dejado los mejores XD jaja

Mario_ergosum dijo...

A mi blog llegan buscando libros, ¿por qué será?, jeje.

Bueno, yo llegué por "lo último en ticoblogger" y ahora sigo viniendo porque me gusta mucho como escribes.


andrés dijo...

No recuerdo como llegue aca pero si por que continue vistando, solo sabor aca!!...

En mi blog curiosamente el detonador fue el post de la diosa del regueton, asi o mas agüebado!!!!???!! jejeje

Uno esperaria que fueran terminos mas inteligentes, que tal vez hiciste un post q cambiara la humanidad cuando en realidad buscan el micro pene jejeje

Un abrazote!

Sathyr dijo...

Yo me lo tope en el feed de ticoblogger...
k de paso es a veces interesante... como para leer en el brete y asi.

GAlcidesS dijo...

Que dicha que no dijo que la "pisé", o tendría problemas... Ja ja ja ja ja ja, saludos.

El mae del bajo dijo...

diay yo llegue aqui de guaba....

saludos Dica

*Dica:Sica=Rica? ¿costa rica? o ¿cosa rica? ahhh por eso es lo de Dica por rica. y que raro no vi esa palabra en el post... plop

Unknown dijo...

Yo la visito por que usted simplemente es encantadora y su blog està pichudisimo!!!

Salu2 de MEAPRIMO.

Carajo dijo...

Yo llegué por el feed de ticoblogger, y me gusto y me quedé Jeje.
Donde ve uno eso,.. Xq yo tengo un contador que dice de que página uno venía, pero eso de las búsquedas está interesante.
Y fijo me tocará postear algo de la diosa del reggueton para elevar visitas Jajaja

KagosaVampire dijo...

Mmm yo llegué también por ticoblogger...


Leda dijo...

Ya antes habias leido tu blog, y me gusta mucho, solo que no comentaba por que yo no tenia, me hice uno por sugerencia de mi prima Marcela, la verdad tu blog es uno de los pocos que leo y que me ha gustado.

Tam dijo...

llegue porque tu llegaste...

solidaridad bloggera...???

el asunto es que tras ese primer coment.. me hice seguidora, eres honesta y tienes buen manejo del lenguaje asi que me agrada mucho leerte, me haces reir en cordialidad


por cierto me sigue dando "cosa" esa foto, alguna idea de como a mis casi 30? aun no puedo leer alicia en el pais de las maravillas ni ver ni una pelicula ???, me causa una angustia idiota


Dica dijo...

palitas: no haré dinero con sus órganos a menos que tenga un micropene por ahí... Mejérese babis!

ps. sonó como mejórese de tener un bebé pufff

Marito: me imagino que por el "ergo sum"... si si, fijo nada que ver.
Por cierto muchas gracias =)

andrésito: solo sabor!! puff jeje si me viera bailando salsa o más bien no bailándola...
Que feo a mi blog tb llegó un montón de gente buscando "diosadas" (un abrazo para ud tb)

Sathyr: yo tb leó en mi tiempo libre solo que a veces se traslapa con el tiempo no libre y es una cagada...

Galci: a ver más respeto que soy una niña, no me corrompa con su mente sucia jeje

Bajillo: su interpretación de mi nick me mató, subliminalmente siempre lo supe jeje nada que ver, pero gracias... creo...

Megaprimo: Gracias!

Carajo: se ve en Analytics de google, ahí salen los pasos, es todo fácil jojo
"Si gente quieres convocar de la diosa tienes que hablar" puff

Vampirita: saluditos! Recuerdo cuando no salía en el feed... que feo jeje

Leda: que bien, nueva! Como ya te dije bienvenida =)
Marcela? la de "mundo perfecto o ideal" o algo así jeje o nada que ver?
PS. Me encanta que te guste mi blogsito!

Tam: Solidaridad jejee en todas!
Por si no se ha dado cuenta todas las imágenes robadas vilmente de su blog o más bien comaprtidas jojo se enlazan a su blog jeje no ve como le hago propaganda jejeje

Que risa tu pánico "Alicio" pero al verdad es que la historia nunca me ha dado confianza... una wila que se va por un hueco... ummm no gracias jeje

Hey vieras que vi "He´s just not that into you" anoche! Buenísima y es como... bastante cierta, me reí montones y el final es todo tierno awww

Saludos Chiquilines
"chiquilines" y todos (creo) son mayores que yo jojo

Marcela dijo...

Dica yo te visito por que tienes un don de gentes maravilloso, y ademàs me gusta tu blog, y ya vistes el blog de mi prima Leda y eso me gusta tambien.
Adaba de paseo, por eso no habia visto los blogs, apenas me estoy poniendo al dìa.

*°·.¸¸.° Heidy °·.¸¸.°* dijo...

Yo creo que un marciano te quiso contactar y escribió en la búsqueda esa palabra impronunciable Jajaja

Yo entre acá porq vi un comentario tuyo en otro blog y me dio curiosidad tú nick


Dica dijo...

Marce! Si era el de tu prima? jeje yo de bateadora solo conozco una marce blogger asi que fijo era la misma jejej nada que ver

Heidy: curiosidad? después de la interpretación del bajillo ya tengo dudas acerca de mi nick y su mensaje subliminal...


Anónimo dijo...

que es un tagline de microsiervos y sigo sin saber que significa :(